| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.184050 |
| Chromosome: | chromosome 8 |
| Location: | 2052417 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g368550 | (1 of 12) IPR000104//IPR002893 - Antifreeze protein, type I // Zinc finger, MYND-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTACTCGCGCCACGGCCCCCGAGCCTGG |
| Internal bar code: | GGGACGGTCCGAGTTCGTTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 943 |
| LEAP-Seq percent confirming: | 98.9071 |
| LEAP-Seq n confirming: | 2353 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGCAAATGGTCGTCTTAC |
| Suggested primer 2: | TTGCTTCTCGAAGAAACCGT |