| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.184062 |
| Chromosome: | chromosome 6 |
| Location: | 8560681 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g308400 | PTN1 | (1 of 1) 3.1.3.16//3.1.3.48//3.1.3.67 - Protein-serine/threonine phosphatase / Serine/threonine specific protein phosphatase // Protein-tyrosine-phosphatase / PTPase // Phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase / Phosphatidylinositol-3,4,5-trisphosphate 3-phosphohydrolase; PTEN PI-3 phosphatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGACATGCCAGGGCCCTGCGCCCCCTGTC |
| Internal bar code: | CGCCCGTAACGGGGGTGTTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 324 |
| LEAP-Seq percent confirming: | 99.787 |
| LEAP-Seq n confirming: | 2342 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCGACCTGGACCTCACAT |
| Suggested primer 2: | CAACGGGTCAGCCTCTCTAC |