| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.184101 |
| Chromosome: | chromosome 12 |
| Location: | 4544662 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g522250 | (1 of 13) PF00350 - Dynamin family (Dynamin_N) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTGCTCCTCCGCTCCGCAAACGCGCCGA |
| Internal bar code: | GTGCTGGGTTAGTCGACTCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 633 |
| LEAP-Seq percent confirming: | 95.8333 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTGAGTGGCGCTATACCC |
| Suggested primer 2: | TGTCCAGCACAGAAGACGAG |