| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.184134 |
| Chromosome: | chromosome 6 |
| Location: | 6286623 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g291400 | GAK2,GALK2 | (1 of 2) IPR006204//IPR006206//IPR013750//IPR020568 - GHMP kinase N-terminal domain // Mevalonate/galactokinase // GHMP kinase, C-terminal domain // Ribosomal protein S5 domain 2-type fold; Galactokinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTTGTAAGGGGCGAGGGGGCGAGCACGT |
| Internal bar code: | CGTCAAGTACTATTAGTTCTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 912 |
| LEAP-Seq percent confirming: | 99.446 |
| LEAP-Seq n confirming: | 8796 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCACATAGCTGAAGAAGCC |
| Suggested primer 2: | GGGGGTGGGAGAATAGGTAA |