Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.184211 |
Chromosome: | chromosome 7 |
Location: | 2051497 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g325762 | FAP82,FBB15,DRC11 | Nexin-dynein regulatory complex 11; (1 of 1) PF00004//PF00612 - ATPase family associated with various cellular activities (AAA) (AAA) // IQ calmodulin-binding motif (IQ) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGGACATGCGAGAGACCATCCAGGACAA |
Internal bar code: | ACCGATTGTGTCATCGCAGAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 261 |
LEAP-Seq percent confirming: | 99.7333 |
LEAP-Seq n confirming: | 374 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCAAACACACACACACACA |
Suggested primer 2: | ATGAGCAGGAGTAGTGGCGT |