Insertion junction: LMJ.RY0402.184300_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.184300
Chromosome:chromosome_12
Location:222487
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre12.g485000 FAP182 Flagellar Associated Protein antisense 5'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CAGCGTACATACTCAGCTTTTCTACAAGCC
Internal bar code:ACTGGCCGTTAAGCGGATCTCC

Confirmation - LEAP-Seq

LEAP-Seq distance:477
LEAP-Seq percent confirming:99.6799
LEAP-Seq n confirming:4671
LEAP-Seq n nonconfirming:15
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:AATGACGCTCCCTCACATTC
Suggested primer 2:CCACATTAGCCTCACCGATT