| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.184304 |
| Chromosome: | chromosome 12 |
| Location: | 4426524 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g521150 | CGL19 | (1 of 1) PTHR31089//PTHR31089:SF1 - FAMILY NOT NAMED // CYCLIC DOF FACTOR 4-RELATED; DOF type transcription factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGAGCTGCATGGCGTCAAGCCTGGTGCT |
| Internal bar code: | GCCCCGCTGCGTTGCAACGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 828 |
| LEAP-Seq percent confirming: | 97.7167 |
| LEAP-Seq n confirming: | 2097 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGGGTGCTAGGTGAAGAG |
| Suggested primer 2: | GATACTAAACGCTCTCGCCG |