Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.184325 |
Chromosome: | chromosome 1 |
Location: | 5181315 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g036050 | MLH1 | DNA mismatch repair protein; (1 of 1) K08734 - DNA mismatch repair protein MLH1 (MLH1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCAGCAGGCCACATTCACACACGAACGA |
Internal bar code: | AACGGCTGTGGTGAAAAGTTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 768 |
LEAP-Seq percent confirming: | 88.6179 |
LEAP-Seq n confirming: | 545 |
LEAP-Seq n nonconfirming: | 70 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGAGTTAAGAGGCGTTGCCA |
Suggested primer 2: | CGATCACCTCTGCCTACACA |