| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.184332 |
| Chromosome: | chromosome 11 |
| Location: | 708528 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467627 | (1 of 1) 1.14.13.134 - Beta-amyrin 11-oxidase / CYP88D6 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCGCCTGCCGTCGCTGCCCAAGGCCCGC |
| Internal bar code: | ACGGGTAAGAGGGTGTCAGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 742 |
| LEAP-Seq percent confirming: | 95.8576 |
| LEAP-Seq n confirming: | 21868 |
| LEAP-Seq n nonconfirming: | 945 |
| LEAP-Seq n unique pos: | 113 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTATGCGCACACAGTCTCT |
| Suggested primer 2: | AACAGATTGATGGCCAGGTC |