Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.184346 |
Chromosome: | chromosome 2 |
Location: | 6941826 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g120100 | RBCS1 | (1 of 2) K01602 - ribulose-bisphosphate carboxylase small chain (rbcS); Ribulose-1%252C5-bisphosphate carboxylase/oxygenase small subunit 1, chloroplastic | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTTTGCTGGTGTTGCTACCCGCCGTTCT |
Internal bar code: | GCCGGTCCATCATCTCGGTTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1001 |
LEAP-Seq percent confirming: | 98.2469 |
LEAP-Seq n confirming: | 2746 |
LEAP-Seq n nonconfirming: | 49 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACAACCGCTACTGGACCAT |
Suggested primer 2: | GGACTCCGTGCAACCACTAT |