Insertion junction: LMJ.RY0402.184445_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.184445
Chromosome:chromosome_6
Location:1736986
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g261750 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TTGTCGCCGACTCGGCGTGCCACTTTGCAG
Internal bar code:ACGCCGAGTTACGAGTGGGGGT

Confirmation - LEAP-Seq

LEAP-Seq distance:1049
LEAP-Seq percent confirming:99.1301
LEAP-Seq n confirming:4558
LEAP-Seq n nonconfirming:40
LEAP-Seq n unique pos:39

Suggested primers for confirmation by PCR

Suggested primer 1:GGTTGAAGAAGCAGGAGACG
Suggested primer 2:GGGTAAGAGCAGGCACAGAG