Insertion junction: LMJ.RY0402.184445_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.184445
Chromosome:chromosome_6
Location:1736989
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g261750 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CCATGGACACAACGTACCTGATGCCTGACC
Internal bar code:TATGTATCTTTGAAGAGATCCC

Confirmation - LEAP-Seq

LEAP-Seq distance:699
LEAP-Seq percent confirming:99.631
LEAP-Seq n confirming:4860
LEAP-Seq n nonconfirming:18
LEAP-Seq n unique pos:7

Suggested primers for confirmation by PCR

Suggested primer 1:GGTTGAAGAAGCAGGAGACG
Suggested primer 2:GGGTAAGAGCAGGCACAGAG