Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.184445 |
Chromosome: | chromosome 6 |
Location: | 1736989 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g261750 | BES3,RBMP1 | (1 of 10) PF01062 - Bestrophin, RFP-TM, chloride channel (Bestrophin); RuBisCO binding membrane protein 1 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATGGACACAACGTACCTGATGCCTGACC |
Internal bar code: | TATGTATCTTTGAAGAGATCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 699 |
LEAP-Seq percent confirming: | 99.631 |
LEAP-Seq n confirming: | 4860 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTTGAAGAAGCAGGAGACG |
Suggested primer 2: | GGGTAAGAGCAGGCACAGAG |