| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.184465 |
| Chromosome: | chromosome 2 |
| Location: | 1881273 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g087600 | SRH2 | SNF2-related DNA/RNA helicase; (1 of 1) K14439 - SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A containing DEAD/H box 1 (SMARCAD1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGGGCGCGGACAGCGGCTTGGTCGGCGG |
| Internal bar code: | ATCAATTTCTATACGACGAGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 254 |
| LEAP-Seq percent confirming: | 4.58453 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 666 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTTGAAGCAGTCCTGGAGC |
| Suggested primer 2: | AGGTTCGGGGTTCTGACTTT |