Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.184465 |
Chromosome: | chromosome 2 |
Location: | 1881418 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g087600 | SRH2 | SNF2-related DNA/RNA helicase; (1 of 1) K14439 - SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A containing DEAD/H box 1 (SMARCAD1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGATGTGTGCAGACCCGCGACACAACCCT |
Internal bar code: | CACTAGCGCAGCTCCTGTGAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 571 |
LEAP-Seq percent confirming: | 99.798 |
LEAP-Seq n confirming: | 494 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGTTCGGGGTTCTGACTTT |
Suggested primer 2: | GTTTGAAGCAGTCCTGGAGC |