| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.184466 |
| Chromosome: | chromosome 6 |
| Location: | 5592153 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g285600 | MID,RWP5 | (1 of 16) PF02042 - RWP-RK domain (RWP-RK); RWP-RK transcription factor | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGAGCAGCCCATCAAGGCGGCCGCCCGC |
| Internal bar code: | ATCTCGCCTCCTTTTCGCGTAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1097 |
| LEAP-Seq percent confirming: | 97.6102 |
| LEAP-Seq n confirming: | 1838 |
| LEAP-Seq n nonconfirming: | 45 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAAGAGGAGGACGAGGATG |
| Suggested primer 2: | CACATGTGTTGTCCTTTGGC |