Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.184532 |
Chromosome: | chromosome 17 |
Location: | 643686 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g700450 | GFY1 | (1 of 1) K07034 - uncharacterized protein (K07034); Putative acetate transporter | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGTGCCGCCAAAAGTGTTGCCCTTGATC |
Internal bar code: | TGTACATTGGACGGGGCCCATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 904 |
LEAP-Seq percent confirming: | 99.8815 |
LEAP-Seq n confirming: | 4214 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACAATTCCTAGCTCCTGC |
Suggested primer 2: | TAGCGTTGTCTGAGGGCTTT |