Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.184547 |
Chromosome: | chromosome 6 |
Location: | 2414361 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g268300 | HTA9 | Histone H2A; (1 of 30) K11251 - histone H2A (H2A) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTCTTGCCCTAGCCAACCCCCACACCCA |
Internal bar code: | CAGAAATGCGACGAGGAGTGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 540 |
LEAP-Seq percent confirming: | 37.9002 |
LEAP-Seq n confirming: | 509 |
LEAP-Seq n nonconfirming: | 834 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGTTGAGCGAACGTGAAAG |
Suggested primer 2: | CTTGGCAGTCTTCTTGGAGG |