| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.184595 |
| Chromosome: | chromosome 10 |
| Location: | 81415 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g418150 | FAP178 | (1 of 1) IPR001715//IPR010441 - Calponin homology domain // CH-like domain in sperm protein; Flagellar Associated Protein 178 | 5'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCACAAGCACACGATAAGACCTGCAATTT |
| Internal bar code: | AAACGTCACAGGGTACGCACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 760 |
| LEAP-Seq percent confirming: | 84.3091 |
| LEAP-Seq n confirming: | 3917 |
| LEAP-Seq n nonconfirming: | 729 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAAGCAGCAGAGCAAACGA |
| Suggested primer 2: | CTTACCGCCTGCAGTTCTTC |