Insertion junction: LMJ.RY0402.184601_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.184601
Chromosome:chromosome_16
Location:7720167
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre16.g691440 FAP43 Flagellar Associated Protein sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CGTGCTCAAGGACGGCGAGGACCGGTCCAG
Internal bar code:GCGTCACCGCGAACTCGTCTCG

Confirmation - LEAP-Seq

LEAP-Seq distance:951
LEAP-Seq percent confirming:95.002
LEAP-Seq n confirming:2376
LEAP-Seq n nonconfirming:125
LEAP-Seq n unique pos:24

Suggested primers for confirmation by PCR

Suggested primer 1:GCCATGAAGGACTTTAAGCG
Suggested primer 2:TCTCGATGAAGGTGGGGTAG