Insertion junction: LMJ.RY0402.184601_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.184601
Chromosome:chromosome_16
Location:7720180
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre16.g691440 FAP43 Flagellar Associated Protein sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GGGCAAGGGGGAGGGAAAGATGAATGCTTC
Internal bar code:GTGCGTTCTTCTTTGAGAGTTG

Confirmation - LEAP-Seq

LEAP-Seq distance:897
LEAP-Seq percent confirming:99.3698
LEAP-Seq n confirming:3311
LEAP-Seq n nonconfirming:21
LEAP-Seq n unique pos:8

Suggested primers for confirmation by PCR

Suggested primer 1:GCCATGAAGGACTTTAAGCG
Suggested primer 2:TCTCGATGAAGGTGGGGTAG