| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.184635 |
| Chromosome: | chromosome 12 |
| Location: | 5976823 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g534800 | GCSP1,GCSP | (1 of 1) 1.4.4.2 - Glycine dehydrogenase (aminomethyl-transferring) / Glycine-cleavage complex P-protein; Glycine cleavage system, P protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCCCACGCCCAGTGCAGCCGAGGACCAC |
| Internal bar code: | CTGGTTGTCGCCGTCCAGCTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 629 |
| LEAP-Seq percent confirming: | 99.723 |
| LEAP-Seq n confirming: | 720 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCAACTCCAAAACACACG |
| Suggested primer 2: | AGGTCCAGGATGAACTCGTG |