| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.184758 |
| Chromosome: | chromosome 3 |
| Location: | 6184381 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g192250 | PHC69 | (1 of 24) IPR003882//IPR024616 - Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 69 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATCTCGAACACTGCGGACCCCGCGTGTTG |
| Internal bar code: | AGGAGTGGGGGGGTGGGCGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 994 |
| LEAP-Seq percent confirming: | 97.8652 |
| LEAP-Seq n confirming: | 5272 |
| LEAP-Seq n nonconfirming: | 115 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGTAGCGGTCAAACCAAT |
| Suggested primer 2: | TGGAGCGGGAAGCTTACTTA |