| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.184828 |
| Chromosome: | chromosome 2 |
| Location: | 4342592 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g099300 | ANK21 | (1 of 15) PF13857 - Ankyrin repeats (many copies) (Ank_5); Predicted protein with ankyrin repeats | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGTGAGAGGAGAGGACAGGAGAGGAGCA |
| Internal bar code: | GCACTATCATGAGGGCGGAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 150 |
| LEAP-Seq percent confirming: | 65.2428 |
| LEAP-Seq n confirming: | 1115 |
| LEAP-Seq n nonconfirming: | 594 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGTGGTAGTGGGAAGCAG |
| Suggested primer 2: | AACCGTCACAATGGAAGAGG |