| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.184985 |
| Chromosome: | chromosome 6 |
| Location: | 4875860 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278900 | NUP88 | (1 of 1) PTHR13257//PTHR13257:SF0 - NUCLEOPORIN NUP84-RELATED // NUCLEAR PORE COMPLEX PROTEIN NUP88; Nucleoporin 88 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACCATCCGGCCCACGCATCCGGCCCCAA |
| Internal bar code: | GGTCGGTTCCTTCGTGAACCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 399 |
| LEAP-Seq percent confirming: | 99.6514 |
| LEAP-Seq n confirming: | 4860 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACGAGAACCTGGTAGAGC |
| Suggested primer 2: | CCATGCAGAGGATGAGGACT |