Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.185018 |
Chromosome: | chromosome 12 |
Location: | 5228461 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g528100 | CPZ | Zinc carboxypeptidase; (1 of 1) PTHR12756:SF12 - CYTOSOLIC CARBOXYPEPTIDASE-LIKE PROTEIN 5 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTGCAAGAGTATGATTGCTGCTACCGCTA |
Internal bar code: | GAGAAAGGTTGCGTGGGATGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 865 |
LEAP-Seq percent confirming: | 99.5342 |
LEAP-Seq n confirming: | 4915 |
LEAP-Seq n nonconfirming: | 23 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTGACAAGAACAAGAGCA |
Suggested primer 2: | ATCGGGCTCATGGAGTTATG |