Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.185061 |
Chromosome: | chromosome 14 |
Location: | 2534990 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g625400 | RPT1 | (1 of 1) K03061 - 26S proteasome regulatory subunit T1 (PSMC2, RPT1); 26S proteasome regulatory subunit | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTCGTTCCTTAACCTCCCCGTACCTCCA |
Internal bar code: | CGGGTGAAGTGCTGCAAATTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 387 |
LEAP-Seq percent confirming: | 83.295 |
LEAP-Seq n confirming: | 2538 |
LEAP-Seq n nonconfirming: | 509 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTAGCCTTTGGCGTCTTCAC |
Suggested primer 2: | GTAGGACACGGGTAAAGGCA |