| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.185075 |
| Chromosome: | chromosome 5 |
| Location: | 764613 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g248500 | TRXO,TRXO1,TRX15 | Thioredoxin o, mitochondrial; (1 of 1) PTHR10438//PTHR10438:SF275 - THIOREDOXIN // THIOREDOXIN O1, MITOCHONDRIAL-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAACTTGCACATGGGTCATGCGAGCTAT |
| Internal bar code: | AGCCAAGGTGGAAACGCAGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 983 |
| LEAP-Seq percent confirming: | 76.7758 |
| LEAP-Seq n confirming: | 1805 |
| LEAP-Seq n nonconfirming: | 546 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGATACCACCGTGTAGGCG |
| Suggested primer 2: | AACGGTGTAAGGGGGCTAAC |