| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.185144 |
| Chromosome: | scaffold 36 |
| Location: | 2214 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre36.g759597 | (1 of 2) IPR001841//IPR013083//IPR024766 - Zinc finger, RING-type // Zinc finger, RING/FYVE/PHD-type // Zinc finger, RING-H2-type | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACGCCGTCCTCCGCGCCGCGCTAAACTA |
| Internal bar code: | GTGGAATCTTCCATCGGGCTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 420 |
| LEAP-Seq percent confirming: | 99.6347 |
| LEAP-Seq n confirming: | 1091 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTGGATGTGTTCTGTCAC |
| Suggested primer 2: | GGGCATGCATTTTGAGCTAT |