| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.185184 |
| Chromosome: | chromosome 10 |
| Location: | 3032825 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g441200 | LAL3 | La-domain RNA-binding protein; (1 of 1) K18757 - la-related protein 1 (LARP1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTGACCGGGGGCTGGTCCGGCTGCAGCAC |
| Internal bar code: | GGGCTTATAAGTCACAACATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 334 |
| LEAP-Seq percent confirming: | 97.0604 |
| LEAP-Seq n confirming: | 3665 |
| LEAP-Seq n nonconfirming: | 111 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGTGTCAAATGCACCCAG |
| Suggested primer 2: | TAGCCGGGGTAGTTGAATTG |