Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.185276 |
Chromosome: | chromosome 9 |
Location: | 2270903 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g392654 | (1 of 3) PF14494 - Domain of unknown function (DUF4436) (DUF4436) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCCTGGGGGTGGCCAGACTGCTGGTGTC |
Internal bar code: | CATTCAATAAGCCTAGCCAGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 838 |
LEAP-Seq percent confirming: | 99.563 |
LEAP-Seq n confirming: | 5696 |
LEAP-Seq n nonconfirming: | 25 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATAGGTTGTGGCGATTCGT |
Suggested primer 2: | ATGCGCACGATTAGCTCTTT |