| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.185324 |
| Chromosome: | chromosome 17 |
| Location: | 4822353 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g733950 | CGL152 | (1 of 90) PF03372 - Endonuclease/Exonuclease/phosphatase family (Exo_endo_phos); Conserved in the Green Lineage | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGTGCGCTGTACACCAGCAGCGGCCCGG |
| Internal bar code: | GGAAGGCAGGTAACGGCTGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1039 |
| LEAP-Seq percent confirming: | 97.779 |
| LEAP-Seq n confirming: | 18006 |
| LEAP-Seq n nonconfirming: | 409 |
| LEAP-Seq n unique pos: | 101 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGTAACTTGGCTGCACGA |
| Suggested primer 2: | GCGAGTTTGAGGAGATCTGG |