| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.185335 |
| Chromosome: | chromosome 7 |
| Location: | 4196920 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g342200 | Dyf-1Fleer,FAP259,IFT70,CrDYF-1,Ttc30 | Intraflagellar Transport Protein 70; (1 of 2) PF13414//PF14559 - TPR repeat (TPR_11) // Tetratricopeptide repeat (TPR_19) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTACCCAGGCCCAACTGCTATCAACCAGG |
| Internal bar code: | CACCGCTTGAGTTCATCGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 560 |
| LEAP-Seq percent confirming: | 99.6923 |
| LEAP-Seq n confirming: | 324 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCTCTTAACTTCGGTGCT |
| Suggested primer 2: | TTTAACGTTGACTACCCCGC |