| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.185336 |
| Chromosome: | chromosome 9 |
| Location: | 6193052 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g405900 | STK | (1 of 3) PTHR23257//PTHR23257:SF518 - SERINE-THREONINE PROTEIN KINASE // DUAL SPECIFICITY PROTEIN KINASE SHKD; Serine/threonine protein kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAATGCGCGAACGGCGGAGCAGTTACAGT |
| Internal bar code: | TCATCACAACTTTTGCGACGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 821 |
| LEAP-Seq percent confirming: | 99.3711 |
| LEAP-Seq n confirming: | 316 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTCGCTAGCATAGGAATG |
| Suggested primer 2: | TACCACGATGGGTGAACTGA |