| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.185492 |
| Chromosome: | chromosome 14 |
| Location: | 2991731 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g628000 | TMX1 | tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase; (1 of 1) 2.1.1.61//2.8.1.4//2.8.1.7 - tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase // tRNA sulfurtransferase // Cysteine desulfurase / Cysteine desulfurylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGACGCGCTCATGTGCTTTCAGAGTCCA |
| Internal bar code: | TGTCTTTTTTAACGGGTATTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 328 |
| LEAP-Seq percent confirming: | 99.6786 |
| LEAP-Seq n confirming: | 1861 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTAGCCCTAACCCCCTCAG |
| Suggested primer 2: | GAGCCAGGTGGTCGTAGAAG |