| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.185634 |
| Chromosome: | chromosome 9 |
| Location: | 6882270 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g410100 | putative Cation-transporting ATPase; (1 of 2) PF00122//PF00689//PF00690//PF00702//PF13246 - E1-E2 ATPase (E1-E2_ATPase) // Cation transporting ATPase, C-terminus (Cation_ATPase_C) // Cation transporter/ATPase, N-terminus (Cation_ATPase_N) // haloacid dehalogenase-like hydrolase (Hydrolase) // Cation transport ATPase (P-type) (Cation_ATPase) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTTGCAGGAGGCTGCCAAGATGGTTTTG |
| Internal bar code: | AGCTAGATTGAAACAGAAATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1064 |
| LEAP-Seq percent confirming: | 99.3596 |
| LEAP-Seq n confirming: | 6051 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 60 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTCGAGATGTCAAGAAGG |
| Suggested primer 2: | CCCAGAGTCACCGACGTAAT |