| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.185789 |
| Chromosome: | chromosome 2 |
| Location: | 6517157 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g116650 | (1 of 7) 3.5.1.52 - Peptide-N(4)-(N-acetyl-beta-glucosaminyl)asparagine amidase / N-oligosaccharide glycopeptidase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCGCACAAGCGTTTACTCCTTCCTCGAC |
| Internal bar code: | AGGCCGGTAGCCGCCCAGCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 408 |
| LEAP-Seq percent confirming: | 98.4277 |
| LEAP-Seq n confirming: | 626 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCACCTTGCGGAACTTCTC |
| Suggested primer 2: | TCATGAGCAGTGGTGGAGAG |