| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.185812 |
| Chromosome: | chromosome 12 |
| Location: | 4215656 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g518772 | (1 of 2) K12893 - splicing factor, arginine/serine-rich 4/5/6 (SFRS4_5_6) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCTTCCTGCTCCCACACTCCCGCCCGT |
| Internal bar code: | CTTGTTATCCGTACCAAGAGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 900 |
| LEAP-Seq percent confirming: | 96.1832 |
| LEAP-Seq n confirming: | 126 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAAGTAAGCAAGGAGGACG |
| Suggested primer 2: | TCACACACCAGACGGATTGT |