| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.185813 |
| Chromosome: | chromosome 11 |
| Location: | 1767552 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467795 | (1 of 1) K05853 - Ca2+ transporting ATPase, sarcoplasmic/endoplasmic reticulum (ATP2A) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTGGCAGGTGATGTGGCAGACGTCGTATG |
| Internal bar code: | GGTTGAACCGCCCGGCGTAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1001 |
| LEAP-Seq percent confirming: | 97.6417 |
| LEAP-Seq n confirming: | 17679 |
| LEAP-Seq n nonconfirming: | 427 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTTGAATGGGGATGTTTGG |
| Suggested primer 2: | GGGAGGTTAGGAATAAGCGG |