| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.185835 |
| Chromosome: | chromosome 9 |
| Location: | 2975551 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g387700 | (1 of 6) PTHR22916//PTHR22916:SF9 - GLYCOSYLTRANSFERASE // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGCAACCGACCCCATTTCGCTTGTGCGA |
| Internal bar code: | GGAACCAAAGACGCGAGCACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 375 |
| LEAP-Seq percent confirming: | 60.0091 |
| LEAP-Seq n confirming: | 2632 |
| LEAP-Seq n nonconfirming: | 1754 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGTGTACGTTGGAGCTGA |
| Suggested primer 2: | ACTGGTGGGCTTAGATGGTG |