Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.185858 |
Chromosome: | chromosome 1 |
Location: | 4840469 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g033550 | PDI2 | (1 of 1) PTHR18929:SF87 - PROTEIN C03H12.1, ISOFORM A; Protein disulfide isomerase 2 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGATGTCTGATGAGGAAGTTCTAGGCCG |
Internal bar code: | GAGCGAACAGGGAAAAGGGCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 846 |
LEAP-Seq percent confirming: | 63.3512 |
LEAP-Seq n confirming: | 2242 |
LEAP-Seq n nonconfirming: | 1297 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTGATCTTTCTGGCGTGCT |
Suggested primer 2: | TGACGAGCACTATCACTCCG |