| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.185863 |
| Chromosome: | chromosome 8 |
| Location: | 1359162 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g364000 | FAP413 | Flagellar Associated Protein 413; (1 of 1) PTHR22847//PTHR22847:SF460 - WD40 REPEAT PROTEIN // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCAAGCTACGGTACTGCCAAGCCCCAA |
| Internal bar code: | CGTTAGATACATTTTCCAGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 567 |
| LEAP-Seq percent confirming: | 98.9418 |
| LEAP-Seq n confirming: | 1122 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCGAGCTGCATCTACCATT |
| Suggested primer 2: | AACATTGCGCAAAGACAGTG |