| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.185966 |
| Chromosome: | chromosome 17 |
| Location: | 768719 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g701500 | DNJ1 | (1 of 1) K09503 - DnaJ homolog subfamily A member 2 (DNAJA2); DnaJ-like protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAGCCCAAACATCGACCCTGAGCACTAA |
| Internal bar code: | GTAGGAACAGGTCATACAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 993 |
| LEAP-Seq percent confirming: | 98.9011 |
| LEAP-Seq n confirming: | 720 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACAATAGCTGCGGTAGCA |
| Suggested primer 2: | TCCCTCTTCTTGGGGTCTTT |