| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.186060 |
| Chromosome: | chromosome 1 |
| Location: | 5328078 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g037350 | TEH2,CGLD2 | Thioesterase family protein; (1 of 2) K17361 - acyl-coenzyme A thioesterase 9 [EC:3.1.2.-] (ACOT9) | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGCAGTCGGGCGGGGGGCGGTGCTTGG |
| Internal bar code: | CTCGGCTGGTCCACTAGGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 648 |
| LEAP-Seq percent confirming: | 99.6907 |
| LEAP-Seq n confirming: | 967 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCTTGAGGACCTGGACTC |
| Suggested primer 2: | TAAGCAGTACCCCACCAAGG |