Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.186079 |
Chromosome: | chromosome 6 |
Location: | 1500753 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g259650 | MPA7 | Metallophosphoesterase/metallo-dependent phosphatase; (1 of 1) PTHR10161 - TARTRATE-RESISTANT ACID PHOSPHATASE TYPE 5 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCGCCATGCACCCCCCGCTCACCAACCG |
Internal bar code: | TGGCGCCGATCATCCCCTAGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 578 |
LEAP-Seq percent confirming: | 99.8679 |
LEAP-Seq n confirming: | 1512 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGTTGCAGAAGCAGTAGCG |
Suggested primer 2: | GCGAGTGCACTTCTACACCA |