Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.186120 |
Chromosome: | chromosome 16 |
Location: | 1370100 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g651923 | CRI1,CRTISO1 | Carotenoid isomerase; (1 of 1) PTHR10668:SF5 - BIOGENESIS OF LYSOSOME-RELATED ORGANELLES COMPLEX 1 SUBUNIT 2 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAAGAAAAAAGGCCCACGCGCAGTGAGG |
Internal bar code: | CTGCTGTCCCGAGGGCGTCTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 723 |
LEAP-Seq percent confirming: | 99.3754 |
LEAP-Seq n confirming: | 3182 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAAACCCCTTCACTTGGTA |
Suggested primer 2: | CTCAGATGTCTGACAGGGCA |