Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.186120 |
Chromosome: | chromosome 16 |
Location: | 1370103 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g651923 | CRI1,CRTISO1 | Carotenoid isomerase; (1 of 1) PTHR10668:SF5 - BIOGENESIS OF LYSOSOME-RELATED ORGANELLES COMPLEX 1 SUBUNIT 2 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGAACATGCCAACACACGTCAAAACTGG |
Internal bar code: | ACGCTTCTAACTCGGAGTTCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 219 |
LEAP-Seq percent confirming: | 99.6245 |
LEAP-Seq n confirming: | 4510 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAAACCCCTTCACTTGGTA |
Suggested primer 2: | CTCAGATGTCTGACAGGGCA |