| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.186240 |
| Chromosome: | chromosome 9 |
| Location: | 4529891 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396065 | ALK5 | (1 of 9) IPR000719//IPR002290//IPR011009//IPR020635//IPR027916 - Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain // Protein kinase-like domain, Apicomplexa; Aurora-like kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCAGGTGATTAGCCGCATTACTCAACTC |
| Internal bar code: | TTGCTAACTGTGGCTTGGCTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 601 |
| LEAP-Seq percent confirming: | 97.5054 |
| LEAP-Seq n confirming: | 899 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAATGTCCTGTCCCTCGTT |
| Suggested primer 2: | CCATACGCTTGCTGTTGAGA |