| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.186333 |
| Chromosome: | chromosome 3 |
| Location: | 1171594 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g149400 | RWP11 | (1 of 1) IPR003035//IPR011989//IPR016181 - RWP-RK domain // Armadillo-like helical // Acyl-CoA N-acyltransferase; RWP-RK transcription factor | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTAATGCCTTCTTTATTTTGGCTGCCGC |
| Internal bar code: | GGTGCGGTCCGTCGCCTTGCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 98 |
| LEAP-Seq percent confirming: | 97.6923 |
| LEAP-Seq n confirming: | 127 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTCCATGCAGGATGAGGAC |
| Suggested primer 2: | CAGATGCCAGGTTCACAATG |