| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.186339 |
| Chromosome: | chromosome 4 |
| Location: | 1433240 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g214250 | AGO2 | Argonaute-like protein; (1 of 3) PTHR22891:SF0 - PROTEIN ARGONAUTE-2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGATTACCGTGACTAAGAAGTGAAGGGCG |
| Internal bar code: | ATGTCAGGGGCAGCCGTTACCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 762 |
| LEAP-Seq percent confirming: | 87.3231 |
| LEAP-Seq n confirming: | 5862 |
| LEAP-Seq n nonconfirming: | 851 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCTGGAGTTCTACAGGGC |
| Suggested primer 2: | GCTCTCACGCTCTACTCGCT |