| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.186365 |
| Chromosome: | chromosome 2 |
| Location: | 7151993 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g146500 | DSK1,DYRK1 | Dual-specificity tyrosine regulated protein kinase; (1 of 1) K18669 - dual specificity tyrosine-phosphorylation-regulated kinase 2/3/4 (DYRK2_3_4) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGAAGAACAGCTTGCGGCGGCTGGCGGCC |
| Internal bar code: | CGAGTCTTTCACTTTCACGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1028 |
| LEAP-Seq percent confirming: | 97.3451 |
| LEAP-Seq n confirming: | 330 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGCCTGCGATACATGAAG |
| Suggested primer 2: | GTTGCTGTTGCTGTTGCTGT |